Tree slime, stump flux and microbial consortia
At this time of year, please watch where you are going in the woods. Strange fluids are oozing, such as this orange paste, seeping from cut hardwood tree trunks, where gnomes with chainsaws were once busy. Get this stuff on your fur, and no one will know what to think.
Root sap gets stirring in the Spring, and even if the stems are gone, the roots may still be alive and pumping liquids, unaware there is no top to feed. Any self-respecting microorganism knows a free meal when it sees one, and soon the watery slime is translucent and greasy with yeast and bacterial and filamentous fungal growth.
My own tree slime is actually relatively modest. Have look at the stumpy volcanos below, photographed last Spring by Jackie Donnelly, one of this Blog’s readers.
Here are some of the budding yeast cells from my tree as seen with the microscope. Orange storage bodies fill up much of each cell. There are lots and lots of yeasts, and most are very talented at growing in watery places with lots of sugar. Then they bud and bud and bud and make their pigments and all their extracellular polysaccharides and make everything nice and mucusy.

Everybody knows about yeasts from the immortal words of Yeats:
Yeast make bread
Yeast make wine
Yeast make you happy
All the time1
Most yeasts are not Saccharomyces, so what species are in this particular slime? In the old days, yeast identification was the work of mad scientists with many suspicious stains on their lab coats. Fifty or sixty different media were needed, each with a unique carbon or nitrogen source. The mad scientist would stab the yeasts into test tubes full of semi-solid gelatin, being careful not to singe their fingers in their bunsen burners. Then they would hold the tubes up to the light, waiting for gas to bubble up from the dividing yeasts into smaller tubes put upsidedown in the bigger tubes, or for dyes in the media to change colours following the release of organic acids. It was an exciting time, but a productive yeast identifier was lucky to identify a dozen yeasts per week.
Nowadays, yeast identification is an entirely modern affair involving singing and dancing and lots of enzymes and machinery. A productive yeast identifier with well developed pipetting muscles can handle hundreds of yeasts per week. Fortunately, I have Molecule Man, and although he only knows four letters of the alphabet, he can extract very long and unique (unpronounceable) words from any living thing. With a culture of our slime yeast, he did his tricks.
Our little yeast is called Cryptococcus macerans2, a basidiomycete yeast first discovered in Denmark, mostly found in sweet wild fluids in frigid parts of the globe such as Iceland and Patagonia and now from wherever it is I live. The orange pigment is of course carotene, the same chemical that colours carrots, and probably my fur. This is one of a group of yeasts that really don’t like each other yeasts very much. They slaughter each other with killer toxins called mycocins.
There are other species in this slime, including moulds like Fusarium and that musical-sounding Acremonium. Actually, a few fungi have only ever been found on cut stumps. Collecting specimens takes great persistence; a Swiss Army Knife will not do. A chisel and a hammer are the usual tools, but despite how careful you are, valuable bits of fungus go flying off into the debris like wayward potato chips. If you try to collect from trunk ends yourself, please wear protective goggles. Some strains of Cryptococcus macerans have actually reportedly been isolated from diseased humans. I’m only a dog, but I do rely on humans to throw Frisbees and I can’t afford to lose you.
If you want to explore this subject further, the May 2006 issue of The Mycologist includes an article about a ‘microbial consortium’ on birch stumps in Germany, with additional lurid photographs of trunk slime that put the most colourful stalagmites to shame. This article, and the followup review of Russian tree slime, will lead you into the deep exotic science of these exudates and some of the species that can be found there.

- Or was it Wordsworth? This poem is usually printed differently, apparently because of a dyslexic typesetter in the swinging 20s who changed it to:
Yeats makes bread
Yeats makes wine
Yeats make you happy
All the time br>Obviously, this is absurd. Home brewing was not allowed in 1923.
- Or if you prefer, the yeast is also known by the name of its sexual state Cystofilobasidium macerans, only described in 2009. It was the internal transcribed spacer (ITS) DNA sequences deposited in GenBank from the description of the sexual state that allowed me to identify my own yeast.
References:
- Libkind, D., Gadaho, M., van Broock, M., and Sampaio, J.P. 2009. Cystofilobasidium lacus-mascardii sp. nov., a basidiomycetous yeast species isolated from aquatic environments of the Patagonian Andes, and Cystofilobasidium macerans sp. nov., the sexual stage of Cryptococcus macerans. Int. J. Syst. and Evol. Microbiol. 59: 622-630.
- Weber, R.W.S., Davoli, P., Anke, H. 2006. A microbial consortium involving the astaxanthin producer Xanthophyllomyces dendrorhous on freshly cut birch stumps in Germany. Mycologist 20: 57-61.
- Weber, R.W.S. 2006. On the ecology of fungal consortia of spring sap-flows. Mycologist 20: 140-143.
The two goopiest, orangest images were kindly shared by Jacqueline Donnelly, who writes a nice nature blog called Saratoga Woods and Waterways. She described her stumps as “kind of icky,” but surely that’s some kind of typo?
Here are the DNA sequences for this yeast if you feel like playing in GenBank again.
ITS sequence:
AGGATCACTAAAGTAAACGCCCTCCGGGGCTCTCTTTATTCACACACCCCTGTGCACTTTGGCCACCTGCCGCGCTT
CACTGCGTTAGTAGGTGTGTCTTTATAATTATACCCATATACACAAGTCATTGAATGTAAAATCGTTATAAACTAATA
TAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTC
ATGAAACTCTCACCTCCAGCCTTCTTTAATTAGAGGTGTTGGGGCGTGGACGTGAGTGCTGCTGGTGCCCTGGTTGC
ATCGGCTCACTTGAAATATGTTAGCTGACTCCTCTAGAGGTGGTTCTACTCGACGTGATAAGATCTCCGTCGAGGAC
AGTGCAACTTGTTGTGCTGGCCGCTCCTAGCAGTTGACGTCGCTTCTAATTAGCGCAGACTTCGAGTGCTGGCAACT
TTTGACAACTTGGCCTCAAATCAGGTAG
28S sequence: CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATT
TAAAATCTGGCAGGCTACGCTTGTCCGAATTGTAATCTCGAGAAGTGTTTTCCGCGTTGGCCTGTGTACAAGTCCCT
TGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACACCCAATGCTTTGTGATACACTCTCAATGA
GTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAG
CGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGA
AACGATTGAAGTCAGTCGTGCCTGCCTAGTCTCAGCCTTTTGGTGTACTACTAGGTCGGCAGGTCAGCATCAGTTTGG
GAGGATTAACAAGGGAGTTAGGAATGTGGCAACCTCGGTTGTGTTATAGCCTAGCTTCGCATTGATCTTGCTGGACTG
AGGAACGCAGTGCGCCCGCAAGGGTTGGTCTTCGGACACATTCGCACTTAGGATGCTGGCATAATGGCTTTAAACGA
CCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTTTGCGAGTCTTTGGGTGGAAAACCCATGGGCGTAATTAATG
TAAATGCAGGTGGGATGCGCAAGCAGCACCATCGACCGATCTGGATCATTTATGTGATGGATTTGAGTAAGAGCACA
TATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGC
GATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCC
TGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGA
TGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTCTTCACTTAATTGGAAGTGGGCATGCGAAT
GAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGCGAGGTTAAGGTGCCGG
AATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCC
GCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATA
CCTCGCCGTCAGCGTTAATGTGATGCGCTGACGAGTAGGCAGGCGTGGAGATTTGTGAAGAAGCCTTGGCAGTGATG
CTGGGTGAAACAGTCTCTAGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAGTGAGAACCTTGAAGACTGAAGTGGA
GAAAGGTTCCATGGTAACAGCAGTTGGACATGGGTTAGTCGATCCTAAGAGATAGGGAAACTCCGTTTTAAAGCGTGC
ACTTGTTTGCACCACTATCGAAAGGGAATCCGGTTAAGATTCCGGAACCAGAATGTGGATCTTTGACGGTAACGTAAA
TGAAGTTGGAGACACTGGCAGGAGCCCTGGGAAGAGTTCTCTTTTCTCCTTAACCGCCTACAACCTTGAAATCGGATT
ATCCGGAGCTAAGGTCGAATGGTGGGTAGAGCTCAGCACTTGTGCTGGGTCCGGTGCGTTCTTGACAGTCCTTGAAAA
TCCAACGGAACGCATAACTTTCA


[...] This post was mentioned on Twitter by P. F. Anderson, David Bockman. David Bockman said: Tree slime, stump flux and microbial consortia : http://is.gd/bSbMY [...]